Review



ifit3  (Santa Cruz Biotechnology)


Bioz Verified Symbol Santa Cruz Biotechnology is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Santa Cruz Biotechnology ifit3
    Ifit3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ifit3/pm41772634-54-6-15?v=Santa+Cruz+Biotechnology
    Average 93 stars, based on 42 article reviews
    ifit3 - by Bioz Stars, 2026-07
    93/100 stars

    Images



    Similar Products

    gene exp ifit3 mm01704846 s1  (Thermo Fisher)
    97
    Thermo Fisher gene exp ifit3 mm01704846 s1
    Gene Exp Ifit3 Mm01704846 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ifit3/pm41772634-87-30--1?v=Thermo+Fisher
    Average 97 stars, based on 1 article reviews
    gene exp ifit3 mm01704846 s1 - by Bioz Stars, 2026-07
    97/100 stars
    		  Buy from Supplier
    ifit3 agctcctctctaactcagagcaac ccactgcaggcttctgatg calonge  (OriGene)
    94
    OriGene ifit3 agctcctctctaactcagagcaac ccactgcaggcttctgatg calonge
    Ifit3 Agctcctctctaactcagagcaac Ccactgcaggcttctgatg Calonge, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ifit3/pm41973907-291-22-53?v=OriGene
    Average 94 stars, based on 1 article reviews
    ifit3 agctcctctctaactcagagcaac ccactgcaggcttctgatg calonge - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    anti ifit3  (Proteintech)
    94
    Proteintech anti ifit3
    Anti Ifit3, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ifit3/bio_rxiv__64898__2026__03__23__713796-52-47-48?v=Proteintech
    Average 94 stars, based on 1 article reviews
    anti ifit3 - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    proteintech 14341 1 ap rabbit anti ifit3  (Proteintech)
    94
    Proteintech proteintech 14341 1 ap rabbit anti ifit3
    Proteintech 14341 1 Ap Rabbit Anti Ifit3, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ifit3/pm41872511-226-127-127?v=Proteintech
    Average 94 stars, based on 1 article reviews
    proteintech 14341 1 ap rabbit anti ifit3 - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    15201 1 ap mouse anti beta actin  (Proteintech)
    94
    Proteintech 15201 1 ap mouse anti beta actin
    15201 1 Ap Mouse Anti Beta Actin, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ifit3/pm41872511-226-134-133?v=Proteintech
    Average 94 stars, based on 1 article reviews
    15201 1 ap mouse anti beta actin - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    ifit3  (Proteintech)
    94
    Proteintech ifit3
    Ifit3, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ifit3/pm41872511-230-21-45?v=Proteintech
    Average 94 stars, based on 1 article reviews
    ifit3 - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    gene exp ifit3 hs01922752 s1  (Thermo Fisher)
    93
    Thermo Fisher gene exp ifit3 hs01922752 s1
    Gene Exp Ifit3 Hs01922752 S1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ifit3/pm41772634-87-9--1?v=Thermo+Fisher
    Average 93 stars, based on 1 article reviews
    gene exp ifit3 hs01922752 s1 - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier
    ifit3  (Santa Cruz Biotechnology)
    93
    Santa Cruz Biotechnology ifit3
    Ifit3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ifit3/pm41772634-54-6-15?v=Santa+Cruz+Biotechnology
    Average 93 stars, based on 1 article reviews
    ifit3 - by Bioz Stars, 2026-07
    93/100 stars
    		  Buy from Supplier

    Image Search Results